Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Zea mays

Total 2638 records in 88 Pages. Current page: 1
1/88 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>


  • Warning: Use of undefined constant help - assumed 'help' (this will throw an Error in a future version of PHP) in /mnt/md0/var/www/html/bioinfor/db/ASmiR/overlap.php on line 376
  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    zma-miR399e-3p,zma-miR399j-3p,zma-miR399i-3p
    2.8
    chr1:203122068-203122087|miR399e-3p,miR399j-3p,miR399i-3p|chr1:203120415-203122122
    Zm00001d031832
    -
    IntronR
    Query:1TGCCAAAGGAGAGTTGCCCTG21
    * | | | | | | | : | | | : | | | | * * | :
    Sbjct:1673CCGGTTTCTTCTTAACG-CAT1654
    TGCCAAAGGAGAGTTGCCCTG
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    2
    zma-miR399e-3p,zma-miR399j-3p,zma-miR399i-3p
    2.8
    chr1:203120651-203120670|miR399e-3p,miR399j-3p,miR399i-3p|chr1:203120415-203120705
    Zm00001d031832
    -
    IntronR
    Query:1TGCCAAAGGAGAGTTGCCCTG21
    * | | | | | | | : | | | : | | | | * * | :
    Sbjct:256CCGGTTTCTTCTTAACG-CAT237
    TGCCAAAGGAGAGTTGCCCTG
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    3
    zma-miR396h,zma-miR396g-5p
    3.0
    chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739450-121744073
    Zm00001d010606
    +
    AltA
    Query:1TCCCACAGCTTTATTGAACTG21
    | | | | | * | | | | | : | | | | * | * | |
    Sbjct:94AGGGTATCGAAGTAACAT-AC75
    TCCCACAGCTTTATTGAACTG
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    4
    zma-miR396h,zma-miR396g-5p
    3.0
    chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739310-121744073
    Zm00001d010606
    +
    IntronR
    Query:1TCCCACAGCTTTATTGAACTG21
    | | | | | * | | | | | : | | | | * | * | |
    Sbjct:234AGGGTATCGAAGTAACAT-AC215
    TCCCACAGCTTTATTGAACTG
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    5
    zma-miR827-5p
    3.0
    chr4:234084645-234084666|miR827-5p|chr4:234084597-234084722
    Zm00001d053559
    -
    IntronR
    Query:1TTTGTTGGTGGTCATTTA-ACC21
    | | | | | | : | | | * | | | | | : | * * | |
    Sbjct:70AAACAATCACAAGTAAGTCAGG49
    TTTGTTGGTGGTCATTTA-ACC
    psRobot
    Nuclear poly(A) polymerase 2
    6
    zma-miR167i-3p,zma-miR167h-3p
    2.5
    chr6:78620119-78620136|miR167i-3p,miR167h-3p|chr6:78618873-78621039
    Zm00001d036240
    +
    IntronR
    Query:1GATCATGTTGCAGCTTCAC19
    * | | | | | | | | | | | : | | : * | |
    Sbjct:1264ATAGTACAACGTTGAG-TG1247
    GATCATGTTGCAGCTTCAC
    psRobot
    Probable beta-13-galactosyltransferase 14
    7
    zma-miR529-5p
    3.0
    chr1:203120493-203120513|miR529-5p|chr1:203120415-203120705
    Zm00001d031832
    -
    IntronR
    Query:1AGAAGAGAGAGAGTACAGCCT21
    * | | | | | | | | | : | | * | | | : * | :
    Sbjct:99GCTTCTCTCTTTCTTGTTAGG79
    AGAAGAGAGAGAGTACAGCCT
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    8
    zma-miR529-5p
    3.0
    chr1:203121910-203121930|miR529-5p|chr1:203120415-203122122
    Zm00001d031832
    -
    IntronR
    Query:1AGAAGAGAGAGAGTACAGCCT21
    * | | | | | | | | | : | | * | | | : * | :
    Sbjct:1516GCTTCTCTCTTTCTTGTTAGG1496
    AGAAGAGAGAGAGTACAGCCT
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    9
    zma-miR529-5p
    2.8
    chr5:691268-691289|miR529-5p|chr5:689692-693376
    Zm00001d012811
    +
    IntronR
    Query:1AGAAGAGAGAGAGTACAGCC-T21
    * | * | | | | | | | | | | : | | | : | | * |
    Sbjct:1598GCGTCTCTCTCTCGTGTTGGTA1577
    AGAAGAGAGAGAGTACAGCC-T
    psRobot
    La-related protein 1C
    10
    zma-miR169o-3p
    3.0
    chr1:245851793-245851811|miR169o-3p|chr1:245850422-245854038
    Zm00001d032989
    +
    IntronR
    Query:1GGCAGGTCTTCTTGGCTAGC20
    | | | | | | | * | | * | | | | | | * | *
    Sbjct:1390CCGTCCAAAACAACCGA-CA1372
    GGCAGGTCTTCTTGGCTAGC
    psRobot
    Serine/threonine-protein phosphatase
    11
    zma-miR169m-3p
    2.5
    chr4:234085038-234085057|miR169m-3p|chr4:234084981-234085993
    Zm00001d053559
    -
    IntronR
    Query:1GGCATCCATTCTTGGCTAAG20
    | | | | | | | | * | | | : | | | | * | *
    Sbjct:77CCGTAGGTCAGAGCCGACTG58
    GGCATCCATTCTTGGCTAAG
    psRobot
    Nuclear poly(A) polymerase 2
    12
    zma-miR169m-3p
    2.5
    chr4:234085047-234085066|miR169m-3p|chr4:234084989-234085994
    Zm00001d053559
    -
    IntronR
    Query:1GGCATCCATTCTTGGCTAAG20
    | | | | | | | | * | | | : | | | | * | *
    Sbjct:78CCGTAGGTCAGAGCCGACTG59
    GGCATCCATTCTTGGCTAAG
    psRobot
    Nuclear poly(A) polymerase 2
    13
    zma-miR169m-3p
    2.5
    chr4:234085058-234085077|miR169m-3p|chr4:234085001-234085993
    Zm00001d053559
    -
    IntronR
    Query:1GGCATCCATTCTTGGCTAAG20
    | | | | | | | | * | | | : | | | | * | *
    Sbjct:77CCGTAGGTCAGAGCCGACTG58
    GGCATCCATTCTTGGCTAAG
    psRobot
    Nuclear poly(A) polymerase 2
    14
    zma-miR164e-5p
    2.8
    chr1:21288663-21288683|miR164e-5p|chr1:21288480-21289262
    Zm00001d028039
    +
    IntronR
    Query:1TGGAGAAGCAGGACACGTGAG21
    | | : | | | | : | | | | | | | * | | : * |
    Sbjct:204ACTTCTTTGTCCTGTTCATAC184
    TGGAGAAGCAGGACACGTGAG
    psRobot
    Probable protein S-acyltransferase 22
    15
    zma-miR159k-3p,zma-miR159b-3p,zma-miR159f-3p,zma-m
    3.0
    chr3:58482466-58482486|miR159k-3p,miR159b-3p,miR159f-3p,miR159j-3p,miR159a-3p|chr3:58482342-58482642
    Zm00001d040691
    +
    IntronR
    Query:1TTTGGATTGAAGGGAGCTCTG21
    | | | | : | | | | | * | | | * | | | * | |
    Sbjct:145AAACTTAACTCCCCACGATAC125
    TTTGGATTGAAGGGAGCTCTG
    psRobot
    Probable receptor-like protein kinase
    16
    zma-miR827-3p
    3.0
    chr3:222361788-222361807|miR827-3p|chr3:222361717-222361937
    Zm00001d044222
    +
    AltA
    Query:1TTAGATGACCATCAGCAAACA21
    | | | : | | : | | * | | | | | | | * | * |
    Sbjct:91AATTTATTGCTAGTCGT-TCT72
    TTAGATGACCATCAGCAAACA
    psRobot
    tetratricopeptide repeat (TPR)-containing protein
    17
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215317-217215959
    Zm00001d044026
    +
    AltA
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:413TCTTCACTTTCTTTCTT-TGA394
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    18
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215046-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:684TCTTCACTTTCTTTCTT-TGA665
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    19
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215044-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:686TCTTCACTTTCTTTCTT-TGA667
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    20
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215571-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:159TCTTCACTTTCTTTCTT-TGA140
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    21
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215031-217215862
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:699TCTTCACTTTCTTTCTT-TGA680
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    22
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215048-217215854
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:682TCTTCACTTTCTTTCTT-TGA663
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    23
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215047-217215959
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:683TCTTCACTTTCTTTCTT-TGA664
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    24
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215529-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:201TCTTCACTTTCTTTCTT-TGA182
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    25
    zma-miR399c-3p,zma-miR399a-3p,zma-miR399h-3p
    2.2
    chr1:203122068-203122087|miR399c-3p,miR399a-3p,miR399h-3p|chr1:203120415-203122122
    Zm00001d031832
    -
    IntronR
    Query:1TGCCAAAGGAGAATTGCCCTG21
    * | | | | | | | : | | | | | | | | * * | :
    Sbjct:1673CCGGTTTCTTCTTAACG-CAT1654
    TGCCAAAGGAGAATTGCCCTG
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    26
    zma-miR399c-3p,zma-miR399a-3p,zma-miR399h-3p
    2.2
    chr1:203120651-203120670|miR399c-3p,miR399a-3p,miR399h-3p|chr1:203120415-203120705
    Zm00001d031832
    -
    IntronR
    Query:1TGCCAAAGGAGAATTGCCCTG21
    * | | | | | | | : | | | | | | | | * * | :
    Sbjct:256CCGGTTTCTTCTTAACG-CAT237
    TGCCAAAGGAGAATTGCCCTG
    psRobot
    Ubiquitin carboxyl-terminal hydrolase 17
    27
    zma-miR395k-3p
    3.0
    chr5:198085742-198085762|miR395k-3p|chr5:198085448-198085960
    Zm00001d017512
    +
    IntronR
    Query:1GTGAAGTGTTTGAGGAAACTC21
    | | | * | | | | | | | | | : : | | | * | *
    Sbjct:315CACATCACAAACTTTTTTTAT295
    GTGAAGTGTTTGAGGAAACTC
    psRobot
    YbaK/aminoacyl-tRNA synthetase-associated domain
    28
    zma-miR393b-3p
    3.0
    chr5:690860-690881|miR393b-3p|chr5:689692-693376
    Zm00001d012811
    +
    IntronR
    Query:1ATCAATGCGATCCTTTTGGAGG22
    | | | | | : : | : | | | * | | | | : | | : |
    Sbjct:1190TAGTTGTGTTAGTAAAATCTTC1169
    ATCAATGCGATCCTTTTGGAGG
    psRobot
    La-related protein 1C
    29
    zma-miR482-3p
    2.8
    chr3:147927497-147927516|miR482-3p|chr3:147927277-147929485
    Zm00001d042033
    -
    IntronR
    Query:1TCTTCCTTGTTCCTCCCATT20
    : | | : | | | | | | | | | : * | | * | |
    Sbjct:240GGAGGGAACAAGGGAGGGAA221
    TCTTCCTTGTTCCTCCCATT
    psRobot
    Pentatricopeptide repeat-containing protein mitochondrial
    30
    zma-miR482-3p
    2.8
    chr3:147927510-147927529|miR482-3p|chr3:147927286-147929489
    Zm00001d042033
    -
    IntronR
    Query:1TCTTCCTTGTTCCTCCCATT20
    : | | : | | | | | | | | | : * | | * | |
    Sbjct:244GGAGGGAACAAGGGAGGGAA225
    TCTTCCTTGTTCCTCCCATT
    psRobot
    Pentatricopeptide repeat-containing protein mitochondrial