Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Oryza sativa

Total 9863 records in 329 Pages. Current page: 1
1/329 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>


  • Warning: Use of undefined constant help - assumed 'help' (this will throw an Error in a future version of PHP) in /mnt/md0/var/www/html/bioinfor/db/ASmiR/overlap.php on line 376
  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    osa-miR5513
    3.0
    chr03:10649280-10649300|miR5513|chr03:10648512-106
    LOC_Os03g19010
    +
    IntronR
    Query:1TAACAAAGGACAACAGACTGA21
    * | | | | | | | : | * * | | | | | | | | |
    Sbjct:789TTTGTTTCTTAGTGTCTGACT769
    TAACAAAGGACAACAGACTGA
    psRobot
    cellular component organization,cellular process,molecular_function,membrane,peroxisome,protein binding
    2
    osa-miR2905
    1.2
    chr01:7898976-7898996|miR2905|chr01:7898099-789909
    LOC_Os01g14100
    -
    IntronR
    Query:1TACATGTCAGTGACAAAGGCA21
    : | | | | | | | | | | | | | | | | | * | *
    Sbjct:898GTGTACAGTCACTGTTTCAGG878
    TACATGTCAGTGACAAAGGCA
    psRobot
    transport,membrane,transporter activity,transport,membrane,transporter activity,transport,membrane,transporter activity
    3
    osa-miR1850.2
    2.8
    chr03:21649380-21649399|miR1850.2|chr03:21649365-2
    LOC_Os03g38970
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    : | | | | | | | | | | * | | | | * | * | |
    Sbjct:35GACACACACTTTATTT-CTCC16
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cytosol
    4
    osa-miR1850.2
    2.5
    chr03:14556858-14556878|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:717AACCCCCACTTGATTTGTGCC697
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    5
    osa-miR1850.2
    2.5
    chr03:14556677-14556697|miR1850.2|chr03:14555898-1
    LOC_Os03g25480
    -
    ExonS
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    6
    osa-miR1850.2
    2.5
    chr03:14557282-14557302|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:1141AACCCCCACTTGATTTGTGCC1121
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    7
    osa-miR1850.2
    2.5
    chr03:14557290-14557310|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:1141AACCCCCACTTGATTTGTGCC1121
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    8
    osa-miR1850.2
    2.5
    chr03:14556859-14556879|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:710AACCCCCACTTGATTTGTGCC690
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    9
    osa-miR1850.2
    2.5
    chr03:14556851-14556871|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:710AACCCCCACTTGATTTGTGCC690
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    10
    osa-miR1850.2
    2.5
    chr03:14556482-14556502|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:333AACCCCCACTTGATTTGTGCC313
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    11
    osa-miR1850.2
    2.5
    chr03:14556941-14556961|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    12
    osa-miR1850.2
    2.5
    chr03:14556474-14556494|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:333AACCCCCACTTGATTTGTGCC313
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    13
    osa-miR1850.2
    2.5
    chr03:14556586-14556606|miR1850.2|chr03:14555898-1
    LOC_Os03g25480
    -
    AltD
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:709AACCCCCACTTGATTTGTGCC689
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    14
    osa-miR1850.2
    2.5
    chr03:14556949-14556969|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    15
    osa-miR1861c
    3.0
    chr03:13880069-13880090|miR1861c|chr03:13880042-13
    LOC_Os03g24380
    +
    ExonS
    Query:1CGATCTTGTAGCAAGAACTGAG22
    * | * | | | | | | * | | | | | | | | | | | *
    Sbjct:49CCGAGAACAGCGTTCTTGACTA28
    CGATCTTGTAGCAAGAACTGAG
    psRobot
    response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
    16
    osa-miR1861c
    3.0
    chr03:13880069-13880090|miR1861c|chr03:13880006-13
    LOC_Os03g24380
    +
    ExonS
    Query:1CGATCTTGTAGCAAGAACTGAG22
    * | * | | | | | | * | | | | | | | | | | | *
    Sbjct:85CCGAGAACAGCGTTCTTGACTA64
    CGATCTTGTAGCAAGAACTGAG
    psRobot
    response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
    17
    osa-miR1872
    3.0
    chr07:1613807-1613829|miR1872|chr07:1613760-161385
    LOC_Os07g03870
    +
    ExonS
    Query:1GAACTGTAAGTCTGTGACGGGTAA24
    * | | | | | | | | : | | | | | | * | : : | | * |
    Sbjct:70ATTGACATTTAGACAC-GTTCAAT48
    GAACTGTAAGTCTGTGACGGGTAA
    psRobot
    biological_process,metabolic process,cellular process,kinase activity,plasma membrane
    18
    osa-miR1872
    3.0
    chr07:1613807-1613829|miR1872|chr07:1613752-161385
    LOC_Os07g03870
    +
    ExonS
    Query:1GAACTGTAAGTCTGTGACGGGTAA24
    * | | | | | | | | : | | | | | | * | : : | | * |
    Sbjct:78ATTGACATTTAGACAC-GTTCAAT56
    GAACTGTAAGTCTGTGACGGGTAA
    psRobot
    biological_process,metabolic process,cellular process,kinase activity,plasma membrane
    19
    osa-miR2919
    2.2
    chr07:4185828-4185846|miR2919|chr07:4185702-418587
    LOC_Os07g08210
    -
    IntronR
    Query:1AAGGGGGGGGGGGGAAAGA19
    | | | | | | | | | | | | * | * | | : |
    Sbjct:145TTCCCCCCCCCCACGTTTT127
    AAGGGGGGGGGGGGAAAGA
    psRobot
    response to stress,response to abiotic stimulus,transferase activity,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,biosynthetic process,biological_process,cytosol,growth,lipid metabolic process,response to stress,response to abiotic stimulus,transferase activity,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,biosynthetic process,biological_process,cytosol,growth,lipid metabolic process,response to stress,response to abiotic stimulus,transferase activity,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,biosynthetic process,biological_process,cytosol,growth,lipid metabolic process
    20
    osa-miR2919
    3.0
    chr08:14729117-14729136|miR2919|chr08:14728321-147
    LOC_Os08g24390
    -
    IntronR
    Query:1AAGGGGGGGGGGGGAAA-GA19
    | | | | | | | | : | * | : | | | | * | |
    Sbjct:816TTCCCCCCTCACTCTTTACT797
    AAGGGGGGGGGGGGAAA-GA
    psRobot
    molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process
    21
    osa-miR2919
    3.0
    chr08:14729120-14729139|miR2919|chr08:14728321-147
    LOC_Os08g24390
    -
    IntronR
    Query:1AAGGGGGGGGGGGGAAA-GA19
    | | | | | | | | : | * | : | | | | * | |
    Sbjct:819TTCCCCCCTCACTCTTTACT800
    AAGGGGGGGGGGGGAAA-GA
    psRobot
    molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process
    22
    osa-miR2919
    3.0
    chr08:14729224-14729243|miR2919|chr08:14728321-147
    LOC_Os08g24390
    -
    AltA
    Query:1AAGGGGGGGGGGGGAAA-GA19
    | | | | | | | | : | * | : | | | | * | |
    Sbjct:923TTCCCCCCTCACTCTTTACT904
    AAGGGGGGGGGGGGAAA-GA
    psRobot
    molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process,molecular_function,biological_process
    23
    osa-miR2923
    3.0
    chr03:35514311-35514332|miR2923|chr03:35514295-355
    LOC_Os03g62750
    +
    IntronR
    Query:1AGACAAAAATATAAATAACAAA22
    * : | | | | | | | | | * | | | | * | | | | |
    Sbjct:38GTTGTTTTTATCTTTACTGTTT17
    AGACAAAAATATAAATAACAAA
    psRobot
    molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process
    24
    osa-miR2923
    3.0
    chr03:35514311-35514332|miR2923|chr03:35514295-355
    LOC_Os03g62750
    +
    IntronR
    Query:1AGACAAAAATATAAATAACAAA22
    * : | | | | | | | | | * | | | | * | | | | |
    Sbjct:38GTTGTTTTTATCTTTACTGTTT17
    AGACAAAAATATAAATAACAAA
    psRobot
    molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process,molecular_function,membrane,plastid,thylakoid,signal transduction,cellular component organization,cellular process
    25
    osa-miR1857-5p
    3.0
    chr04:27824440-27824461|miR1857-5p|chr04:27824270-
    LOC_Os04g46930
    -
    IntronR
    Query:1TGGTTTTTTTGGAGCATGA-GG21
    * : | | | | | : | | | : | | | | | | | * * |
    Sbjct:192TTCAAAAGAACTTCGTACTGAC171
    TGGTTTTTTTGGAGCATGA-GG
    psRobot
    metabolic process,cellular process,catalytic activity,metabolic process,cellular process,catalytic activity
    26
    osa-miR1850.1
    1.5
    chr03:14556882-14556902|miR1850.1|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    | | | | | | | | | | | : | | * | | | | | |
    Sbjct:741ACCTTTCAACCTTCAAACCCC721
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    27
    osa-miR1850.1
    1.5
    chr03:14556701-14556721|miR1850.1|chr03:14555898-1
    LOC_Os03g25480
    -
    ExonS
    Query:1TGGAAAGTTGGGAGATTGGGG21
    | | | | | | | | | | | : | | * | | | | | |
    Sbjct:824ACCTTTCAACCTTCAAACCCC804
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    28
    osa-miR1850.1
    1.5
    chr03:14557306-14557326|miR1850.1|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    | | | | | | | | | | | : | | * | | | | | |
    Sbjct:1165ACCTTTCAACCTTCAAACCCC1145
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    29
    osa-miR1850.1
    1.5
    chr03:14557314-14557334|miR1850.1|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    | | | | | | | | | | | : | | * | | | | | |
    Sbjct:1165ACCTTTCAACCTTCAAACCCC1145
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    30
    osa-miR1850.1
    1.5
    chr03:14556883-14556903|miR1850.1|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    | | | | | | | | | | | : | | * | | | | | |
    Sbjct:734ACCTTTCAACCTTCAAACCCC714
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding