Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Glycine max

Total 18404 records in 614 Pages. Current page: 1
1/614 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>


  • Warning: Use of undefined constant help - assumed 'help' (this will throw an Error in a future version of PHP) in /mnt/md0/var/www/html/bioinfor/db/ASmiR/overlap.php on line 376
  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR171i-5p
    3.0
    chr12:10762811-10762830|miR171i-5p|chr12:10762789-10762927
    GLYMA12G12530
    -
    AltD
    Query:1ATAAGAAAGCAATGCTCAAA20
    | | | | | | | | : | * | | | * | | | | *
    Sbjct:42TATTCTTTTGATACTAGTTA23
    ATAAGAAAGCAATGCTCAAA
    psRobot
    unknown protein
    2
    gma-miR1523a
    3.0
    chr8:16285291-16285310|miR1523a|chr8:16285228-16285670
    GLYMA08G21440
    +
    IntronR
    Query:1ATGGGATAAATGTGAGCTCA20
    | | * : | | | | | | | | | : | | | | * *
    Sbjct:83TAATCTATTTACATTCGAAC64
    ATGGGATAAATGTGAGCTCA
    psRobot
    nucleotidyltransferase family protein
    3
    gma-miR1508c
    2.8
    chr2:45078352-45078372|miR1508c|chr2:45078021-45078574
    GLYMA02G39870
    -
    IntronR
    Query:1TAGAAAGGGAAATAGCAGTTG21
    | | | | * | : : | | | | | | | | | | : : :
    Sbjct:352ATCTGTTTCTTTATCGTCGGT332
    TAGAAAGGGAAATAGCAGTTG
    psRobot
    WRKY33; transcription factor
    4
    gma-miR156e,gma-miR156d,gma-miR156c,gma-miR156m,gm
    2.8
    chr11:38132905-38132924|miR156e,miR156d,miR156c,miR156m,miR156l,miR156i,miR156j|chr11:38132567-38132932
    GLYMA11G36800
    +
    IntronR
    Query:1TTGACAGAAGATAGAGAGCAC21
    | : : | | | : | | | | | | | | : | : * | |
    Sbjct:358AGTTGTTTTCTATCTTTT-TG339
    TTGACAGAAGATAGAGAGCAC
    psRobot
    DNA topoisomerase family protein
    5
    gma-miR156e,gma-miR156d,gma-miR156c,gma-miR156m,gm
    2.8
    chr11:38132905-38132924|miR156e,miR156d,miR156c,miR156m,miR156l,miR156i,miR156j|chr11:38132567-38132937
    GLYMA11G36800
    +
    IntronR
    Query:1TTGACAGAAGATAGAGAGCAC21
    | : : | | | : | | | | | | | | : | : * | |
    Sbjct:358AGTTGTTTTCTATCTTTT-TG339
    TTGACAGAAGATAGAGAGCAC
    psRobot
    DNA topoisomerase family protein
    6
    gma-miR9726
    2.8
    chr6:11247351-11247372|miR9726|chr6:11247252-11247719
    GLYMA06G14290
    -
    IntronR
    Query:1TATAGGCATTATTTTTTTCTTC22
    * | | | * | | | | | | | | | | : | : | | | *
    Sbjct:121CTATGCGTAATAAAAGAGGAAC100
    TATAGGCATTATTTTTTTCTTC
    psRobot
    NTL9 (NAC transcription factor-like 9); transcription factor
    7
    gma-miR9726
    3.0
    chr3:42572312-42572333|miR9726|chr3:42571646-42572355
    GLYMA03G35300
    +
    ExonS
    Query:1TATAGGCATTATTTTTTTCTTC22
    | | | * : | | | | | * | | | | | | * | | | |
    Sbjct:688ATAGTCGTAACAAAAAACGAAG667
    TATAGGCATTATTTTTTTCTTC
    psRobot
    unknown protein
    8
    gma-miR9726
    3.0
    chr3:42572312-42572333|miR9726|chr3:42571291-42572355
    GLYMA03G35300
    +
    ExonS
    Query:1TATAGGCATTATTTTTTTCTTC22
    | | | * : | | | | | * | | | | | | * | | | |
    Sbjct:1043ATAGTCGTAACAAAAAACGAAG1022
    TATAGGCATTATTTTTTTCTTC
    psRobot
    unknown protein
    9
    gma-miR9726
    3.0
    chr3:42572312-42572333|miR9726|chr3:42571342-42572355
    GLYMA03G35300
    +
    AltD
    Query:1TATAGGCATTATTTTTTTCTTC22
    | | | * : | | | | | * | | | | | | * | | | |
    Sbjct:992ATAGTCGTAACAAAAAACGAAG971
    TATAGGCATTATTTTTTTCTTC
    psRobot
    unknown protein
    10
    gma-miR4995
    3.0
    chr18:6235514-6235533|miR4995|chr18:6235462-6236343
    GLYMA18G07530
    +
    IntronR
    Query:1AGGCAGTGGCTTGGTTAAGGG21
    | : | | | : | | | | | | | | | * | * | | *
    Sbjct:72TTCGTTACCGAACCATT-CCA53
    AGGCAGTGGCTTGGTTAAGGG
    psRobot
    GIL1 (GRAVITROPIC IN THE LIGHT)
    11
    gma-miR4995
    2.8
    chr6:2572793-2572813|miR4995|chr6:2572583-2573476
    GLYMA06G03670
    +
    AltA
    Query:1AGGCAGTGGCTTGGTTAAGGG21
    | : | | | : | | | | | | : | | | | * : : :
    Sbjct:231TTCGTTACCGAATCAATATTT211
    AGGCAGTGGCTTGGTTAAGGG
    psRobot
    JAC1 (J-DOMAIN PROTEIN REQUIRED FOR CHLOROPLAST ACCUMULATION RESPONSE 1); heat shock protein binding
    12
    gma-miR5670a
    3.0
    chr7:3801640-3801661|miR5670a|chr7:3801490-3801708
    GLYMA07G05130
    -
    IntronR
    Query:1CATCATACCATATTTGCTTCAT22
    * | | | | | * | | | | | | * | | | | | | | *
    Sbjct:172TTAGTAGGGTATATACGAAGTT151
    CATCATACCATATTTGCTTCAT
    psRobot
    ALAAT2 (ALANINE AMINOTRANSFERASE 2); ATP binding / L-alanine:2-oxoglutarate aminotransferase
    13
    gma-miR2606a,gma-miR2606b
    2.8
    chr12:8613071-8613091|miR2606a,miR2606b|chr12:8612658-8613299
    GLYMA12G10650
    +
    IntronR
    Query:1AAAAGCACTTAAGGAACGGTA21
    | | | | | * | | : | | | : | | | | * : | |
    Sbjct:434TTTTCATGGATTTCTTGATAT414
    AAAAGCACTTAAGGAACGGTA
    psRobot
    ATGLR3.4; intracellular ligand-gated ion channel
    14
    gma-miR9722
    3.0
    chr13:28105607-28105627|miR9722|chr13:28104581-28105724
    GLYMA13G24780
    +
    IntronR
    Query:1TAATAGAGGGAAGAAGATGAA21
    * | | | | * | | | | | | | | | : | | * | *
    Sbjct:1047TTTATGTCCCTTCTTTTAGTA1027
    TAATAGAGGGAAGAAGATGAA
    psRobot
    EMB2001 (embryo defective 2001); GTP binding
    15
    gma-miR9722
    2.8
    chr2:44323831-44323851|miR9722|chr2:44323710-44324219
    GLYMA02G39010
    -
    IntronR
    Query:1TAATAGAGGGAAGAAGATGAA21
    | | | : | | | : | | | | : | | : | * : | |
    Sbjct:142ATTGTCTTCCTTTTTTTTTTT122
    TAATAGAGGGAAGAAGATGAA
    psRobot
    glycosyl hydrolase family 3 protein
    16
    gma-miR167d,gma-miR167a,gma-miR167b
    3.0
    chr10:45565432-45565452|miR167d,miR167a,miR167b|chr10:45565234-45565704
    GLYMA10G37610
    +
    AltA
    Query:1TGAAGCTGCCAGCATGATCTA21
    | | | | | | | | | * | | | * | | | * * | |
    Sbjct:219ACTTCGACGTTCGCACTCTAT199
    TGAAGCTGCCAGCATGATCTA
    psRobot
    FRO2 (FERRIC REDUCTION OXIDASE 2); ferric-chelate reductase
    17
    gma-miR5559
    3.0
    chr17:37530578-37530597|miR5559|chr17:37529523-37530884
    GLYMA17G33600
    -
    AltD
    Query:1TACTTGGTGAATTGTTGGATC21
    * * | | | | | | | | * | | | | | | | * | |
    Sbjct:1075CGGAACCACTGAACAACC-AG1056
    TACTTGGTGAATTGTTGGATC
    psRobot
    unknown protein
    18
    gma-miR5559
    3.0
    chr17:37529746-37529765|miR5559|chr17:37529586-37529989
    GLYMA17G33600
    -
    IntronR
    Query:1TACTTGGTGAATTGTTGGATC21
    * * | | | | | | | | * | | | | | | | * | |
    Sbjct:180CGGAACCACTGAACAACC-AG161
    TACTTGGTGAATTGTTGGATC
    psRobot
    unknown protein
    19
    gma-miR5559
    3.0
    chr17:37529788-37529807|miR5559|chr17:37529628-37529989
    GLYMA17G33600
    -
    IntronR
    Query:1TACTTGGTGAATTGTTGGATC21
    * * | | | | | | | | * | | | | | | | * | |
    Sbjct:180CGGAACCACTGAACAACC-AG161
    TACTTGGTGAATTGTTGGATC
    psRobot
    unknown protein
    20
    gma-miR156b
    3.0
    chr11:301778-301797|miR156b|chr11:301760-301831
    GLYMA11G00640
    +
    IntronR
    Query:1TGACAGAAGAGAGAGAGCACA21
    | | | | | : | | | | : | | | : | : * | * |
    Sbjct:38ACTGTTTTCTTTCTTTTAT-T19
    TGACAGAAGAGAGAGAGCACA
    psRobot
    ATCHR12; ATP binding / DNA binding / helicase/ nucleic acid binding
    21
    gma-miR156aa,gma-miR156z
    3.0
    chr17:37529603-37529620|miR156aa,miR156z|chr17:37529586-37529673
    GLYMA17G33600
    -
    AltA
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | | : | | | : | | * | : | : | |
    Sbjct:35TAACTTCATTTACTTTGA18
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    22
    gma-miR156aa,gma-miR156z
    3.0
    chr17:37530751-37530768|miR156aa,miR156z|chr17:37529523-37530884
    GLYMA17G33600
    -
    AltD
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | | : | | | : | | * | : | : | |
    Sbjct:1246TAACTTCATTTACTTTGA1229
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    23
    gma-miR156aa,gma-miR156z
    3.0
    chr17:37529540-37529557|miR156aa,miR156z|chr17:37529523-37529673
    GLYMA17G33600
    -
    ExonS
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | | : | | | : | | * | : | : | |
    Sbjct:35TAACTTCATTTACTTTGA18
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    24
    gma-miR156aa,gma-miR156z
    3.0
    chr2:48212120-48212137|miR156aa,miR156z|chr2:48211708-48212197
    GLYMA02G43440
    +
    ExonS
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | * | | | | * * | | | | | | | |
    Sbjct:430TAAACTCAGGTCCCTCGA413
    ATTGGAGTGAAGGGAGCT
    psRobot
    GDSL-motif lipase/hydrolase family protein
    25
    gma-miR156aa,gma-miR156z
    3.0
    chr5:277811-277828|miR156aa,miR156z|chr5:277745-278416
    GLYMA05G00550
    +
    IntronR
    Query:1ATTGGAGTGAAGGGAGCT18
    * | | | : | : | | * | | | : | | | |
    Sbjct:84AAACTTTACCTCCTTCGA67
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    26
    gma-miR156aa,gma-miR156z
    3.0
    chr17:37529919-37529936|miR156aa,miR156z|chr17:37529586-37529989
    GLYMA17G33600
    -
    IntronR
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | | : | | | : | | * | : | : | |
    Sbjct:351TAACTTCATTTACTTTGA334
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    27
    gma-miR156aa,gma-miR156z
    3.0
    chr17:37529961-37529978|miR156aa,miR156z|chr17:37529628-37529989
    GLYMA17G33600
    -
    IntronR
    Query:1ATTGGAGTGAAGGGAGCT18
    | | | | : | | | : | | * | : | : | |
    Sbjct:351TAACTTCATTTACTTTGA334
    ATTGGAGTGAAGGGAGCT
    psRobot
    unknown protein
    28
    gma-miR9752
    3.0
    chr2:51168051-51168072|miR9752|chr2:51168018-51168109
    GLYMA02G47640
    +
    ExonS
    Query:1TGCTTCTTCTTTTCCCTGT-TT21
    | * | | | | | | | | | | | * | | | * | * | |
    Sbjct:55AAGAAGAAGAAAAAGGAAACAA34
    TGCTTCTTCTTTTCCCTGT-TT
    psRobot
    PAT1 (phytochrome a signal transduction 1); signal transducer/ transcription factor
    29
    gma-miR9752
    3.0
    chr2:51168051-51168072|miR9752|chr2:51168018-51168077
    GLYMA02G47640
    +
    ExonS
    Query:1TGCTTCTTCTTTTCCCTGT-TT21
    | * | | | | | | | | | | | * | | | * | * | |
    Sbjct:55AAGAAGAAGAAAAAGGAAACAA34
    TGCTTCTTCTTTTCCCTGT-TT
    psRobot
    PAT1 (phytochrome a signal transduction 1); signal transducer/ transcription factor
    30
    gma-miR156f
    2.8
    chr11:301778-301798|miR156f|chr11:301760-301831
    GLYMA11G00640
    +
    IntronR
    Query:1TTGACAGAAGAGAGAGAGCACA22
    | | | | | | : | | | | : | | | : | : * | * |
    Sbjct:39AACTGTTTTCTTTCTTTTAT-T19
    TTGACAGAAGAGAGAGAGCACA
    psRobot
    ATCHR12; ATP binding / DNA binding / helicase/ nucleic acid binding