Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Arabidopsis

Total 16722 records in 558 Pages. Current page: 1
1/558 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>


  • Warning: Use of undefined constant help - assumed 'help' (this will throw an Error in a future version of PHP) in /mnt/md0/var/www/html/bioinfor/db/ASmiR/circ_miRNA.php on line 310
  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    ath-miR8165
    chr03:4683462-4683482
    AT3G14120
    +
    A5BS
    TTCTTCACTTTTGCCTCTGTT
    AATGGAGGCAAGTGTGAAGGA
    miRferno
    AT3G14120|NUP107|MAG2
    2
    ath-miR5021
    chr01:19167325-19167344
    AT1G51690
    +
    A5BS
    TTTCTTTCCTCTTTTTCTTA
    TGAGAAGAAGAAGAAGAAAA
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    3
    ath-miR156h
    chr02:12268310-12268329
    AT2G28620
    -
    A5BS
    CTGCTCTATTATTTCTGCCA
    TGACAGAAGAAAGAGAGCAC
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    4
    ath-miR156h
    chr01:19167075-19167094
    AT1G51690
    +
    A5BS
    GAGCTCTTTTTCTCCTCTCG
    TGACAGAAGAAAGAGAGCAC
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    5
    ath-miR156h
    chr01:19167075-19167094
    AT1G51690
    +
    A5BS
    GAGCTCTTTTTCTCCTCTCG
    TGACAGAAGAAAGAGAGCAC
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    6
    ath-miR156h
    chr01:19167330-19167349
    AT1G51690
    +
    A5BS
    TTCCTCTTTTTCTTATGTGA
    TGACAGAAGAAAGAGAGCAC
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    7
    ath-miR156i
    chr02:12268310-12268329
    AT2G28620
    -
    A5BS
    CTGCTCTATTATTTCTGCCA
    TGACAGAAGAGAGAGAGCAG
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    8
    ath-miR172d-5p
    chr02:12268834-12268854
    AT2G28620
    -
    A5BS
    GCTGAATCTAGTTGATCTTGC
    GCAACATCTTCAAGATTCAGA
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    9
    ath-miR5017-5p
    chr02:12268592-12268612
    AT2G28620
    -
    A5BS
    CATTCCATATAGGTAACAGAA
    ATTTGTTACTAATTTGGAATG
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    10
    ath-miR172b-5p;ath-miR172e-5p
    chr01:19167286-19167305
    AT1G51690
    +
    A5BS
    GTGTATCTAAATGGTTCTAC
    GCAGCACCATTAAGATTCAC
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    11
    ath-miR415
    chr01:19169626-19169646
    AT1G51690
    +
    A5BS
    CTCTTCTGTTTTTTCTCTCTT
    AACAGAGCAGAAACAGAACAT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    12
    ath-miR415
    chr01:19167586-19167606
    AT1G51690
    +
    A5BS
    ATGTTTTCTTTATTCTCTGTG
    AACAGAGCAGAAACAGAACAT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    13
    ath-miR415
    chr01:19167586-19167606
    AT1G51690
    +
    A5BS
    ATGTTTTCTTTATTCTCTGTG
    AACAGAGCAGAAACAGAACAT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    14
    ath-miR2112-5p
    chr01:19169442-19169462
    AT1G51690
    +
    A5BS
    ATTTTGTTATTCGCATTTTCG
    CGCAAATGCGGATATCAATGT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    15
    ath-miR2112-5p
    chr01:19169442-19169462
    AT1G51690
    +
    A5BS
    ATTTTGTTATTCGCATTTTCG
    CGCAAATGCGGATATCAATGT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    16
    ath-miR2112-5p
    chr01:19169442-19169462
    AT1G51690
    +
    A5BS
    ATTTTGTTATTCGCATTTTCG
    CGCAAATGCGGATATCAATGT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    17
    ath-miR2112-5p
    chr01:19169442-19169462
    AT1G51690
    +
    A5BS
    ATTTTGTTATTCGCATTTTCG
    CGCAAATGCGGATATCAATGT
    miRferno
    AT1G51690|ATB ALPHA|B ALPHA|protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform|F19C24
    18
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    19
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    20
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    21
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    22
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    23
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    24
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    25
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    26
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    27
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    28
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    29
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2
    30
    ath-miR847
    chr04:12392078-12392098
    AT4G23800
    +
    A5BS
    GACCAAGAAGAAGAAGAACGA
    TCACTCCTCTTCTTCTTGATG
    miRferno
    AT4G23800|3xHMG-box2|3xHigh Mobility Group-box2